Lesson · 40 min · Free
Sequencing Reads & Platforms
Sequencing Reads & Platforms body { font-family: sans-serif; line-height: 1.6; color: #333; } h1 { color: #0056b3; } h2 { color: #007bff; border-bottom: 2px solid #eee; padding-bottom: 10px; margin-top: 30px; } p { margi
Sequencing Reads & Platforms
Welcome to the "Sequencing Reads & Platforms" lesson, a foundational component of our Bioinformatics & Computational Genomics course. In the era of personalized medicine and advanced biotechnology, understanding how genetic information is captured and processed is paramount. This lesson will delve into the fundamental concepts of sequencing reads, the raw data generated by sequencing instruments, and introduce you to the major platforms that produce this data. We will focus on the characteristics of these reads, their formats, and how different technologies impact downstream bioinformatics analyses. At its core, DNA sequencing aims to determine the precise order of nucleotides (A, T, C, G) within a DNA molecule. Modern sequencing technologies, often termed Next-Generation Sequencing (NGS) or High-Throughput Sequencing (HTS), have revolutionized this process, enabling the rapid and cost-effective sequencing of entire genomes, transcriptomes, and epigenomes. However, these technologies do not read an entire chromosome in one go. Instead, they break down the DNA into smaller fragments, sequence these fragments, and then use computational methods to reassemble the original sequence.
Understanding Sequencing Reads
A "sequencing read" is a short segment of DNA sequence determined by a sequencing instrument. The length of these reads can vary significantly depending on the sequencing technology used. For instance, early Sanger sequencing produced reads of up to 1000 base pairs (bp), while current Illumina platforms typically generate reads between 50 bp and 300 bp. Newer "long-read" technologies from Pacific Biosciences (PacBio) and Oxford Nanopore Technologies (ONT) can produce reads tens of thousands to even millions of base pairs long. Each read is accompanied by quality scores, which indicate the confidence in the base call at each position. These scores are crucial for downstream analysis, as low-quality bases can lead to errors in variant calling, genome assembly, and other applications. Quality scores are often represented in a compressed format, such as the Phred quality score scale, where a score of Q30 means there's a 1 in 1000 chance of an incorrect base call (99.9% accuracy). Sequencing reads are typically stored in FASTQ format, which combines the sequence information with its corresponding quality scores. A FASTQ entry consists of four lines: Line starting with @ : Sequence identifier and optional description. Raw sequence data (the nucleotides). Line starting with + : Optional description (can be empty or repeat the identifier). Quality scores for each base in the sequence, encoded as ASCII characters. Here's an example of a FASTQ entry: @M00967:14:000000000-A9M7B:1:1101:17009:1990 1:N:0:1 GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + BCFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF In this example, GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT is the DNA sequence, and BCFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF represents the quality scores. Each character in the quality score line corresponds to a base in the sequence, with higher ASCII values indicating higher quality.
Major Sequencing Platforms
The choice of sequencing platform significantly impacts the experimental design, cost, and the type of bioinformatics analysis required. Here, we'll briefly cover some of the most widely used platforms: 1. Illumina (Short-Read Sequencing) Illumina platforms dominate the sequencing market due to their high throughput, accuracy, and relatively low cost per base. They utilize a technology called "sequencing by synthesis" (SBS). DNA is fragmented, adapters are ligated, and then fragments are amplified on a flow cell to create clusters of identical DNA molecules. Each cluster is then sequenced simultaneously by adding fluorescently labeled reversible terminators and capturing images at each cycle. After each base incorporation, the fluorescent tag is cleaved, and the 3' blocker is removed, allowing the next base to be added. Read Length: Typically 50-300 bp (paired-end reads). Throughput: Extremely high (terabases per run). Accuracy: Very high, especially in the middle of reads (Q30+). Applications: Whole-genome sequencing (WGS), exome sequencing, RNA-seq, ChIP-seq, metagenomics. 2. Pacific Biosciences (PacBio) (Long-Read Sequencing) PacBio sequencing, particularly with its Single Molecule, Real-Time (SMRT) sequencing technology, offers significantly longer reads. In SMRT sequencing, DNA polymerase synthesizes a new strand while fluorescently labeled nucleotides are incorporated. The light emitted from each incorporation event is detected in real-time. A key advantage is that it sequences individual DNA molecules, avoiding PCR amplification bias and allowing for the detection of epigenetic modifications directly. Read Length: Up to tens of thousands of base pairs (e.g., 10-25 kb average, up to >100 kb). Throughput: Moderate compared to Illumina. Accuracy: Historically lower per-base accuracy than Illumina, but consensus accuracy (after circular consensus sequencing, CCS) can be very high. Applications: De novo genome assembly (especially for complex genomes), structural variant detection, full-length transcript sequencing (Iso-Seq), epigenetic analysis. 3. Oxford Nanopore Technologies (ONT) (Long-Read Sequencing) ONT platforms, such as the MinION and PromethION, also provide long reads by detecting changes in electrical current as a DNA strand passes through a nanoscale pore. Each nucleotide causes a characteristic disruption in the current, which is then interpreted to determine the sequence. ONT offers portability (MinION) and scalability (PromethION), and the ability to sequence in real-time. Read Length: Highly variable, from a few kb to millions of base pairs (record >4 Mb). Throughput: Variable, from relatively low (MinION) to high (PromethION). Accuracy: Per-base accuracy is improving rapidly but can be lower than Illumina. High-accuracy reads (Q20+) are achievable with newer chemistries and basecalling algorithms. Applications: Rapid outbreak sequencing, de novo genome assembly, structural variant detection, direct RNA sequencing, real-time sequencing. The choice between short-read and long-read technologies often depends on the research question. Short reads are excellent for detecting single nucleotide polymorphisms (SNPs) and small indels, quantifying gene expression, and resequencing known genomes. Long reads are invaluable for resolving complex genomic regions, assembling novel genomes, and detecting large structural variations that short reads often miss due to their inability to span repetitive or highly polymorphic regions. Understanding the characteristics of reads from different platforms is critical for selecting appropriate bioinformatics tools and pipelines. For instance, aligning short reads to a reference genome is a different computational challenge than aligning long, error-prone reads. Similarly, de novo assembly algorithms are specifically designed to handle the strengths and weaknesses of each read type.
Code Example: Basic FASTQ Parsing
While dedicated libraries exist for robust FASTQ parsing, a simple Python script can illustrate how to extract sequence and quality information: def parse_fastq_entry(fastq_lines): if len(fastq_lines) != 4: raise ValueError("FASTQ entry must have 4 lines.") header = fastq_lines[0].strip() sequence = fastq_lines[1].strip() plus_line = fastq_lines[2].strip() quality_scores = fastq_lines[3].strip() return { "header": header, "sequence": sequence, "quality_scores_string": quality_scores, "quality_scores_phred": [ord(c) - 33 for c in quality_scores] # Convert to Phred scores } # Example usage with a dummy FASTQ entry dummy_fastq = [ "@read1_id some description", "AGCTAGCTAGCT", "+", "IIIIIIIIIIII" # All bases with Q=40 ] entry_data = parse_fastq_entry(dummy_fastq) print(f"Header: {entry_data['header']}") print(f"Sequence: {entry_data['sequence']}") print(f"Phred Quality Scores: {entry_data['quality_scores_phred']}") # A more complex example with varying quality dummy_fastq_low_high = [ "@read2_id another description", "GATACA", "+", "BCEFFF" # Q=33,34,36,37,37,37 ] entry_data_2 = parse_fastq_entry(dummy_fastq_low_high) print(f"\nHeader: {entry_data_2['header']}") print(f"Sequence: {entry_data_2['sequence']}") print(f"Phred Quality Scores: {entry_data_2['quality_scores_phred']}") This script demonstrates how to parse a single FASTQ entry and convert the ASCII quality scores into their numerical Phred equivalents. The Phred score is calculated as Q = -10 * log10(P) , where P is the probability of an incorrect base call. Conversely, P = 10^(-Q/10) . The ASCII offset for Phred+33 encoding (common in Illumina) is 33, meaning a character with ASCII value 33 ( ! ) corresponds to Q0, and ASCII 74 ( J ) corresponds to Q41.
Key Takeaways
Sequencing reads are short DNA fragments sequenced by high-throughput platforms, accompanied by quality scores. The FASTQ format is the standard for storing sequencing reads and their quality information. Illumina (short-read) platforms offer high throughput and accuracy, ideal for resequencing and quantification. PacBio and ONT (long-read) platforms provide significantly longer reads, crucial for de novo assembly and structural variant detection. The choice of sequencing platform depends on the specific research question and has a direct impact on downstream bioinformatics analysis strategies. Understanding quality scores is essential for filtering low-quality data and ensuring reliable results.
Practice Exercise
Imagine you are a bioinformatician in a pharmaceutical company tasked with identifying a novel bacterial strain causing an outbreak. You have access to both an Illumina MiSeq and an Oxford Nanopore MinION. Describe a scenario where you would prioritize using the MinION over the MiSeq, and explain why. Conversely, describe a scenario where the MiSeq would be the preferred choice. Consider factors like read length, throughput, accuracy, and real-time analysis capabilities in your reasoning.
Watch the full lesson — free
This topic is part of Bioinformatics & Computational Genomics, a complete AI-narrated video course. Press play once and watch the entire lecture like a movie.
Start the course free →